View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_44 (Length: 242)
Name: NF11758_low_44
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 12120872 - 12120672
Alignment:
| Q |
1 |
tcttctcctccttttctatattcttcctcttcaacataactctttgtaaccataaccaatttgcacatcccatttattgagttgttgagagcagtgccta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12120872 |
tcttctcctccttttctatattcttcctcttcaacataactctttgtaaccataaccaatttgcatgtcccatttattgagttgttgagagcagtgccta |
12120773 |
T |
 |
| Q |
101 |
agactccaacttcagatagattagaaagtttagttgcaatctgacctacttgagtttccaaatattaatggaggatttagtattcctttggggtccctca |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12120772 |
agactccagcttcagatagattagaaagtttagttgcaatttgacctacttgagtttccaaatattaatggaggattcagtattcctttggggtccctca |
12120673 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
12120672 |
t |
12120672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University