View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_47 (Length: 240)
Name: NF11758_low_47
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 26503779 - 26503675
Alignment:
| Q |
18 |
tgtgtgtgtgtaaaaattataaactgcaacatgtactcggtataacatttaccaatatcgaaatgcagaaagtcctgtttgttagactacatgctagagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26503779 |
tgtgtgtgtgtaaaaattataaactgcaacatatactcaatataacatttaccaatatcgaaatgcagaaagtcctgtttgttagactatatgctagagc |
26503680 |
T |
 |
| Q |
118 |
acatg |
122 |
Q |
| |
|
||||| |
|
|
| T |
26503679 |
acatg |
26503675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University