View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_48 (Length: 238)
Name: NF11758_low_48
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_48 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 43244257 - 43244034
Alignment:
| Q |
15 |
agaaataacatgacagatttcattaaaggaacaatttttaagctttcaaacatcacccaatacaataatcatcagaaggcaataaactttaaaaattaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244257 |
agaaataacatgacagatttcattaaaggaacaatttttaagctttcaaacatcacccaatacaataatcatcagaaggcaataaactttaaaaattaaa |
43244158 |
T |
 |
| Q |
115 |
gctttaacggtgccgtttacctgagccataacagcggcgaccgacattccaagaggaaaaccaatagctgcaacattaataccccttgtgcgacgaacag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43244157 |
gctttaacggtgccgtttacctgagccataacagcggcgaccgacattccaagaggaaaaccaatagctgcaacattattaccccttgtgcgacgaacag |
43244058 |
T |
 |
| Q |
215 |
agactctagggtttcgtcgtttgc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43244057 |
agactctagggtttcgtcgtttgc |
43244034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University