View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_52 (Length: 218)
Name: NF11758_low_52
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 13144145 - 13144348
Alignment:
| Q |
1 |
tgtttggttcactagtgccctatggtgcgtatctcatgcatgttaaatttgtgtaagtttggttatttaacttcgtacattgttttcattattttgattt |
100 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13144145 |
tgtttggttcaccaatgccctatggtgcgtatctcatgcatgttaaatttgtgtaagtttggtaatttaacttcgtacattgttttcattattt-gattt |
13144243 |
T |
|
| Q |
101 |
gttctttattcattcttgaatcgaataattatagtgaaaaatactaattattgtaagtttggttattattgaataacgatattttattatttttggtctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13144244 |
gttctttattcattcttgaatcgaataattatagtgaaaaatactaattattgtaagtttggttattattgaataacgatattttatcatttttggtctt |
13144343 |
T |
|
| Q |
201 |
gttct |
205 |
Q |
| |
|
||||| |
|
|
| T |
13144344 |
gttct |
13144348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 137
Target Start/End: Original strand, 13144719 - 13144757
Alignment:
| Q |
99 |
ttgttctttattcattcttgaatcgaataattatagtga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
13144719 |
ttgttctttattcattcttgaatcgaattattacagtga |
13144757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University