View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11759_low_4 (Length: 328)
Name: NF11759_low_4
Description: NF11759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11759_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 27679451 - 27679760
Alignment:
| Q |
1 |
atgaactagtacttgaaaattgtccaaaacaccgattacaactgatgttaccgttcaaaagtagaagctcgtaatcccctttctcctcacaattgagaag |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| | |
|
|
| T |
27679451 |
atgaactaccacttgaaaattgtccaaaacaccgattacaactgatgttaccgttcaaaagtagaagctcgtagtcccctttctcttcacaattgagacg |
27679550 |
T |
|
| Q |
101 |
g-cgagtttatcgatgccaattttataataacaaagaaaacaaatgagttaagttttgaggagcattattttgtttttcttgtttttgtcaaattgagat |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27679551 |
ggcgagtttatcgatgccaattttataataacaaagaaaacaaatgagttaagttttgaggagcattattttgtttgtcttgtttttgtcaaattgagat |
27679650 |
T |
|
| Q |
200 |
tgatcatatcagtgtctcagtcattacaacaaagaagacattgaacttctatttctgaaagccggtatcaatcatcgttgaagttttagatgattttcaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27679651 |
tgatcatatcagtgtctcagtcattacaacaaagaagacattgaacttctatttctgaaagctggtatcaatcatcgttgaagttttagatgattttcaa |
27679750 |
T |
|
| Q |
300 |
gtactgatcc |
309 |
Q |
| |
|
| |||||||| |
|
|
| T |
27679751 |
gcactgatcc |
27679760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University