View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_11 (Length: 297)
Name: NF1175_high_11
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 45 - 290
Target Start/End: Complemental strand, 27288141 - 27287888
Alignment:
| Q |
45 |
agcttcaaaaacaataagggaatggtatattcacaattatgaaacagtttgtcactaaaaaatatacaccttcaatttcatgtcataaatatgtaaaagt |
144 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27288141 |
agcttcaaaaacaatatgggaatggtatattcacaattatgaaacagtttgtcactaaaaaacatacaccttcaattttatgtcataaatatgtaaaagt |
27288042 |
T |
 |
| Q |
145 |
tactttgaaaaagcaaggcatattatgttttt-------cac-caaaagaatacttgatattagttatgtgtgaatcttatcagtcattgccgcgttgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| | | |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27288041 |
tactttgaaaaagcaaggcatattatgtttttctaatgccacaccagagaatacttgatattagttatgtgtgaatcttatcagtcactgccgcgttgtt |
27287942 |
T |
 |
| Q |
237 |
ttgtttggttcaggtggtgttccctggtttcagagcgcgttacctttcatctca |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27287941 |
ttgtttggttcaggtggtgttccctggtttcagagcgcgttacctttcttctca |
27287888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University