View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_12 (Length: 272)
Name: NF1175_high_12
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 112 - 247
Target Start/End: Complemental strand, 54803033 - 54802898
Alignment:
| Q |
112 |
taaaattttcttctcaacttgagtaataacccgtccttttcattttaacttgagtaataactttccaccacaaatagctcatgaaacacacctctatttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803033 |
taaaattttcttctcaacttgagtaataacctgtccttttcattttaacttgagtaataactttccaccacaaatagctcatgaaacacacctctatttc |
54802934 |
T |
 |
| Q |
212 |
atcacactactttgattctatgctttatgacattgg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54802933 |
atcacactactttgattctatgctttatgacattgg |
54802898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 51 - 120
Target Start/End: Complemental strand, 54803487 - 54803418
Alignment:
| Q |
51 |
ataacaatattatggtgtcaccatggtttcgtcaatttcatttgcccgtataatcatgctataaaatttt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54803487 |
ataacaatattatggtgtcaccatggtttcgtcaatttcatttgcccatataatcatgctataaaatttt |
54803418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University