View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_21 (Length: 241)
Name: NF1175_high_21
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 29 - 215
Target Start/End: Original strand, 6315214 - 6315401
Alignment:
| Q |
29 |
aagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtagatggaaaaaaccacaacaggggtacttgtcatatggcaacaggtg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315214 |
aagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtagatggaaaagaccacaacaggggtacttgtcatatggcaacaggtg |
6315313 |
T |
 |
| Q |
129 |
gattagtagcaacggagacttgttgggcagat-ggatccctttacaaatgaagatgaagtgatggctttatggagggttatggagtga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6315314 |
gattagtagcaacggagacttgttgggcagatgggatccctttacaaatgaagatgaagtgacggctttatggagggttatggagtga |
6315401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University