View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_24 (Length: 209)
Name: NF1175_high_24
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 50 - 112
Target Start/End: Original strand, 44297832 - 44297894
Alignment:
| Q |
50 |
ctgcgtttgatgatcttctcggtggatttgggaataataagccttcccgtcaaaggtgtggtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44297832 |
ctgcgtttgatgatcttctcggtggatttgggaataataagccttcccgtcaaaggtgtggtt |
44297894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 44297708 - 44297759
Alignment:
| Q |
1 |
gattccttctccgatctcttcaattccaatcccatctctcgtagcacctctg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44297708 |
gattccttctccgatctcttcaattccaatcccatctctcgtagcacctctg |
44297759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 13843635 - 13843603
Alignment:
| Q |
51 |
tgcgtttgatgatcttctcggtggatttgggaa |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
13843635 |
tgcgtttgatgatcttcttggtggatttgggaa |
13843603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University