View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_25 (Length: 209)
Name: NF1175_high_25
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 44297732 - 44297613
Alignment:
| Q |
1 |
aattgaagagatcggagaaggaatcggaatcatgattggaagagtgaaaggatcgggaatgtgaatcgaagttgagagaggaggttttggtgaaattaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
44297732 |
aattgaagagatcggagaaggaatcggaatcatgattggaagagtgaaaggatcgggaatgtgaatcgaagttgagagaggaagttttggtgaaattgga |
44297633 |
T |
|
| Q |
101 |
agatcctttgaatgatgatg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44297632 |
agatcctttgaatgatgatg |
44297613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University