View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_26 (Length: 202)
Name: NF1175_high_26
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 41892901 - 41892700
Alignment:
| Q |
1 |
atatgtttcttatgcttgtcactataatttatatctactatatgccgtaacgtttatgttctcttttgatgtgatgagcatatacttgcatccagaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41892901 |
atatgtttcttatgcttgtcactataatttatatctactgtatgccatgacgtttatgttctcttttgatgtgatgagcatatacttgcatccagaatct |
41892802 |
T |
|
| Q |
101 |
ctgttgccttgatagtgattataggggcctattgttctgtcttatatgaacatgaaaaatattgctaacatcatattgtccccaaaatcgttttgaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41892801 |
ctgttgccttgatagtgattataggggcctattgttctgtcttatatgaacatgaaaaatattgctaacatcatattgtccccaaaatcgttttgaatta |
41892702 |
T |
|
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
41892701 |
tt |
41892700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University