View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_4 (Length: 330)
Name: NF1175_high_4
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 67 - 307
Target Start/End: Complemental strand, 6315310 - 6315070
Alignment:
| Q |
67 |
ctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315310 |
ctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg |
6315211 |
T |
|
| Q |
167 |
ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctcttccatatattccacaacaccat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315210 |
ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctcttccatatattccacaacaccat |
6315111 |
T |
|
| Q |
267 |
agttaaaccattcataatcattgttgtgcagttgttgatga |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315110 |
agttaaaccattcataatcattgttgtgcagttgttgatga |
6315070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University