View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1175_high_6 (Length: 305)

Name: NF1175_high_6
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1175_high_6
NF1175_high_6
[»] chr1 (1 HSPs)
chr1 (67-244)||(6315133-6315310)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 67 - 244
Target Start/End: Complemental strand, 6315310 - 6315133
Alignment:
67 ctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg 166  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6315310 ctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg 6315211  T
167 ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctct 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6315210 ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctct 6315133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University