View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_high_9 (Length: 299)
Name: NF1175_high_9
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 6 - 109
Target Start/End: Complemental strand, 43966156 - 43966053
Alignment:
| Q |
6 |
aggagcagagaggacatggaaatggttgaggacgatgaggagtttgggtttatatatgctgctaaccatgcgtactggaaagtgcaatgtcgttttcgtt |
105 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
43966156 |
aggaacagagaggacatggaaatggttcaggacgatgaggagtttgggtttatatatgctgctacccatgcgtgctggaaagtgcaatgtcgttttcgtt |
43966057 |
T |
 |
| Q |
106 |
ctca |
109 |
Q |
| |
|
|||| |
|
|
| T |
43966056 |
ctca |
43966053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 43965988 - 43965949
Alignment:
| Q |
175 |
ccaaacacaatgatacttgtttggttgtaccttctggctt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43965988 |
ccaaacacaatgatacttgtttggttgtaccttctggctt |
43965949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University