View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_low_13 (Length: 397)
Name: NF1175_low_13
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 137 - 383
Target Start/End: Complemental strand, 22792305 - 22792059
Alignment:
| Q |
137 |
tatacagtgaatgatgagttgtttgggtggggcttcaatcgggattctcctaatccggattcctttgaatcactgactacacgcattcacgtagttatgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792305 |
tatacagtgaatgatgagttgtttgggtggggcttcaatcgggattctcctaatccgaattcctttgaatcactgactacacgcattcacgtagttatgt |
22792206 |
T |
|
| Q |
237 |
gatctgcgagcgttcgatcgagatccaatagttttagttttgaagaaaatcaaaatatgtttaatctttagaccattagatgtttgatcgagattgaacg |
336 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| | | |
|
|
| T |
22792205 |
gatttgcgagcgttcgatcgagatccaatagttttagttttgaagaaaatcaaaatatgtttaatttttggaccattagatgtttgatcgagattggaag |
22792106 |
T |
|
| Q |
337 |
gtcacaaatctcatgactacgagaatgtgtagtaagtgactgtagtt |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22792105 |
gtcacaaatctcatgactacgagaatgtgtagtaagtgactatagtt |
22792059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 29 - 141
Target Start/End: Complemental strand, 22792437 - 22792324
Alignment:
| Q |
29 |
aatatgtacgtgcatatattttttgggggaatggggaacaaatgaattaactaagagtgggatagtgttagttgttggaatggcatatattc-ggggtgt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22792437 |
aatatgtacgtgcatatattttttgggggaatggggaacaaatgaattaactaagagtgggatagtgttagttgttggaatggcatatattcgggggtgt |
22792338 |
T |
|
| Q |
128 |
aatatatgatatac |
141 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22792337 |
gatatatgatatac |
22792324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University