View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_low_22 (Length: 301)
Name: NF1175_low_22
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 29 - 249
Target Start/End: Complemental strand, 2415797 - 2415573
Alignment:
| Q |
29 |
aagaatggattctactcgaactcaatgtaattcgttcctcaatctctctccctccatttctcagtttcattagcnnnnnnnnnnnnnngaaatcggtact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2415797 |
aagaatggattctactcgaactcaatgtaattcgttcctcaatctctctccctccatttctcagtttcattagcttttttattttt--gaaatcggtact |
2415700 |
T |
 |
| Q |
129 |
taggttattgaattttactatactta------gagagtgttcgtgctgaaattttgtaaatcgattttgannnnnnnaattaagttaatgaagtttctcg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2415699 |
taggttattgaattttactatacttatacttagagagtgttcgtgctgaaattttgtaaatcgattttgatttttttaattaagttaatgaagtttctcg |
2415600 |
T |
 |
| Q |
223 |
aattgtgattttaggtttcttgcttta |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2415599 |
aattgtgattttaggtttcttgcttta |
2415573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University