View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_low_24 (Length: 299)
Name: NF1175_low_24
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 271
Target Start/End: Complemental strand, 42011696 - 42011434
Alignment:
| Q |
9 |
gagatgaagaggaagccaaagcaaattttgatgcctggcatgaaacacctgaattaaagtcaccttcccctttcgaaaaacaactgttgttagtttatag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42011696 |
gagatgaagaggaagccaaagcaaattttgatgcctggcatgaaacacctgaattaaagtcaccttcccctttcgaaaaacaactgttgttagtttatac |
42011597 |
T |
|
| Q |
109 |
tcatgaaatctatcaaaagtttcagttcgaggttttgggtgcttctgcttgccatctaaagaaagaaaatgatggcgtgattactacttatgatgtgaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42011596 |
tcatgaaatctatcaaaagtttcagttcgaggttttgggtgcttctgcttgccatctaaagaaagaaaatgatggtgtgattactacttatgatgtgaaa |
42011497 |
T |
|
| Q |
209 |
gacttcgaaaataatcagaactacatggtagaatggaacacatcaaactcggatatatgttgt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42011496 |
gacttcgaaaataatcagaactacatggtagaatggaacacatcaaactcggatatatgttgt |
42011434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University