View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1175_low_28 (Length: 261)

Name: NF1175_low_28
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1175_low_28
NF1175_low_28
[»] chr3 (2 HSPs)
chr3 (24-130)||(44840506-44840612)
chr3 (24-102)||(44852272-44852350)
[»] chr8 (1 HSPs)
chr8 (160-238)||(41564714-41564792)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 24 - 130
Target Start/End: Original strand, 44840506 - 44840612
Alignment:
24 ctgttcaggatcattacttttgtcagtcaatcattaacacgaaggttaagtgattaaaacattacaacacagaaggagcctcacaaaataccattcaata 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44840506 ctgttcaggatcattacttttgtcagtcaatcattaacacgaaggttaagtgattaaaacattacaacacagaaggagcctcacaaaataccattcaata 44840605  T
124 agaataa 130  Q
    |||||||    
44840606 agaataa 44840612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 44852272 - 44852350
Alignment:
24 ctgttcaggatcattacttttgtcagtcaatcattaacacgaaggttaagtgattaaaacattacaacacagaaggagc 102  Q
    |||||||||||| |||||||| ||||||||||||||| || | |||||||| |||||| ||| | || |||||||||||    
44852272 ctgttcaggatcgttacttttatcagtcaatcattaatactagggttaagtaattaaaccatcataatacagaaggagc 44852350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 41564792 - 41564714
Alignment:
160 agagagaatcttgatccttgtccaactatgtgaagttggtggatgggggtggacggtgatgtttcatttgtagcctaaa 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41564792 agagagaatcttgatccttgtccaactatgtgaagttggtggatgggggtggacggtgatgtttcatttgtagcctaaa 41564714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University