View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_low_28 (Length: 261)
Name: NF1175_low_28
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 24 - 130
Target Start/End: Original strand, 44840506 - 44840612
Alignment:
| Q |
24 |
ctgttcaggatcattacttttgtcagtcaatcattaacacgaaggttaagtgattaaaacattacaacacagaaggagcctcacaaaataccattcaata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44840506 |
ctgttcaggatcattacttttgtcagtcaatcattaacacgaaggttaagtgattaaaacattacaacacagaaggagcctcacaaaataccattcaata |
44840605 |
T |
 |
| Q |
124 |
agaataa |
130 |
Q |
| |
|
||||||| |
|
|
| T |
44840606 |
agaataa |
44840612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 44852272 - 44852350
Alignment:
| Q |
24 |
ctgttcaggatcattacttttgtcagtcaatcattaacacgaaggttaagtgattaaaacattacaacacagaaggagc |
102 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| || | |||||||| |||||| ||| | || ||||||||||| |
|
|
| T |
44852272 |
ctgttcaggatcgttacttttatcagtcaatcattaatactagggttaagtaattaaaccatcataatacagaaggagc |
44852350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 41564792 - 41564714
Alignment:
| Q |
160 |
agagagaatcttgatccttgtccaactatgtgaagttggtggatgggggtggacggtgatgtttcatttgtagcctaaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41564792 |
agagagaatcttgatccttgtccaactatgtgaagttggtggatgggggtggacggtgatgtttcatttgtagcctaaa |
41564714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University