View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1175_low_29 (Length: 259)
Name: NF1175_low_29
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1175_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 37 - 112
Target Start/End: Complemental strand, 33770546 - 33770471
Alignment:
| Q |
37 |
agtatataagtatgagttgaatgaatgattcttatatggacacaaaactttggtcacatcatttgattacactcac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770546 |
agtatataagtatgagttgaatgaatgattcttatatggacacaaaactttggtcacatcatttgattacactcac |
33770471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 33770393 - 33770348
Alignment:
| Q |
190 |
aagtgtgtgatcaaatcatgtgtcaaaatatttaggtccacacagg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770393 |
aagtgtgtgatcaaatcatgtgtcaaaatatttaggtccacacagg |
33770348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 233
Target Start/End: Original strand, 39068994 - 39069036
Alignment:
| Q |
191 |
agtgtgtgatcaaatcatgtgtcaaaatatttaggtccacaca |
233 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
39068994 |
agtgtgtgaccaaatcatgtgtctaaatctttaggtccacaca |
39069036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University