View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1175_low_37 (Length: 241)

Name: NF1175_low_37
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1175_low_37
NF1175_low_37
[»] chr1 (1 HSPs)
chr1 (29-215)||(6315214-6315401)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 29 - 215
Target Start/End: Original strand, 6315214 - 6315401
Alignment:
29 aagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtagatggaaaaaaccacaacaggggtacttgtcatatggcaacaggtg 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
6315214 aagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtagatggaaaagaccacaacaggggtacttgtcatatggcaacaggtg 6315313  T
129 gattagtagcaacggagacttgttgggcagat-ggatccctttacaaatgaagatgaagtgatggctttatggagggttatggagtga 215  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
6315314 gattagtagcaacggagacttgttgggcagatgggatccctttacaaatgaagatgaagtgacggctttatggagggttatggagtga 6315401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University