View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1175_low_38 (Length: 241)

Name: NF1175_low_38
Description: NF1175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1175_low_38
NF1175_low_38
[»] chr3 (1 HSPs)
chr3 (112-147)||(53491223-53491258)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 147
Target Start/End: Original strand, 53491223 - 53491258
Alignment:
112 aacctgtgaaaaattgaagtgatttatttggtatct 147  Q
    ||||||||||||||||||||||||||||||||||||    
53491223 aacctgtgaaaaattgaagtgatttatttggtatct 53491258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University