View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11760_high_18 (Length: 225)
Name: NF11760_high_18
Description: NF11760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11760_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 51000542 - 51000672
Alignment:
| Q |
1 |
gatagaatgattaaaaatacttgaacactgcannnnnnnn--aagacaacactgctaataaattttggatagattgtttgattaactttaaaaaatagtt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51000542 |
gatagaatgattaaaaatacttgaacactgcattttttttttaaggcaacactgctaataaattttggatagattgtttgattaactttaaaaaata-tt |
51000640 |
T |
 |
| Q |
99 |
cgcaaaattacgcaaacagtctcttaacttaa |
130 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |
|
|
| T |
51000641 |
ggcaaaattacgcaaacagtcccttatcttaa |
51000672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University