View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11760_high_20 (Length: 206)
Name: NF11760_high_20
Description: NF11760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11760_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 9 - 188
Target Start/End: Original strand, 31009161 - 31009340
Alignment:
| Q |
9 |
agaagcagagaacacaaaaatggggtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaa |
108 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009161 |
agaagcacacaacacaaaaatggggtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaa |
31009260 |
T |
 |
| Q |
109 |
acctttgcaaacctcttcattgcaattgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009261 |
acctttgcaaacctcttcattgcaattgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggat |
31009340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University