View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11760_low_13 (Length: 287)
Name: NF11760_low_13
Description: NF11760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11760_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 15 - 287
Target Start/End: Original strand, 38924556 - 38924828
Alignment:
| Q |
15 |
cagagagattatggattgagaaagtggttgtggcaggtagtttaggaacattgtggtggtggaagttgagagaggaagttgagaatttaggtgttatggc |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924556 |
cagaaagattatggattgagaaagtggttgtggcaggtagtttaggaacattgtggtggtggaagttgagagaggaagttgagaatttaggtgttatggc |
38924655 |
T |
 |
| Q |
115 |
tgaaacnnnnnnngatgaaatgatggaggtgggaatagaagaatttgttggttggtggttgtattatttaactgttacaattggtatggtgaggattgtg |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924656 |
tgaaacaaagaaagatgaaatgatggaggtgggaatagaagaatttgttggttggtggttgtattatttaactgttacaattggtatggtgaggattgtg |
38924755 |
T |
 |
| Q |
215 |
aaaggtcttatgtggattttcatgatttctctatgtagaagaagggtaacacagattaatgaggtggaattgg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924756 |
aaaggtcttatgtggattttcatgatttctctatgtagaagaagggtaacacagattaatgaggtggaattgg |
38924828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 158 - 234
Target Start/End: Complemental strand, 44842171 - 44842095
Alignment:
| Q |
158 |
tttgttggttggtggttgtattatttaactgttacaattggtatggtgaggattgtgaaaggtcttatgtggatttt |
234 |
Q |
| |
|
|||||||| ||||| ||||||||||| ||||| |||||||| ||||| | | |||| || ||||||||||||||||| |
|
|
| T |
44842171 |
tttgttgggtggtgtttgtattatttgactgtaacaattgggatggtaaaggttgtaaagggtcttatgtggatttt |
44842095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University