View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11760_low_18 (Length: 239)
Name: NF11760_low_18
Description: NF11760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11760_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 39336262 - 39336416
Alignment:
| Q |
1 |
ctcttgcaaagggtagacgtattgatgccagcgtggatttgagtct--cattgcaagaatggaagattgtgaaaactttagtggcgcggatcttgctgca |
98 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336262 |
ctcttgcaaagggtagacatattgatgccagcgtggatttgagtgtgtcattgcaagaatggaagattgtgaaaactttagtggcgcggatcttgctgca |
39336361 |
T |
|
| Q |
99 |
ttggtatgtttctactctattttagtttgtatcgactccctatgttcagttccat |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39336362 |
ttggtatgtttctactctattttagtttgtatcgactccctatgttcggttccat |
39336416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 24 - 103
Target Start/End: Complemental strand, 7295508 - 7295429
Alignment:
| Q |
24 |
gatgccagcgtggatttgagtctcattgcaagaatggaagattgtgaaaactttagtggcgcggatcttgctgcattggt |
103 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| ||| |||| ||||||||| ||| || ||||||||||||||||| |
|
|
| T |
7295508 |
gatgccagtgtggatttgagcgacattgcaagaatgaaagcttgtaaaaactttaatggtgctgatcttgctgcattggt |
7295429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 7304746 - 7304663
Alignment:
| Q |
20 |
tattgatgccagcgtggatttgagtctcattgcaagaatggaagattgtgaaaactttagtggcgcggatcttgctgcattggt |
103 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| |||| | ||| |||||||||| |||||| || ||||||||||||||||| |
|
|
| T |
7304746 |
tattgatgccagtgtggatttgagcgccattggaagatcgaaagcctgtgaaaactatagtggtgccgatcttgctgcattggt |
7304663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 113
Target Start/End: Original strand, 790938 - 791004
Alignment:
| Q |
47 |
cattgcaagaatggaagattgtgaaaactttagtggcgcggatcttgctgcattggtatgtttctac |
113 |
Q |
| |
|
||||| ||||||||| | ||||||||| |||| || || |||||||||| |||||||||||||||| |
|
|
| T |
790938 |
cattggaagaatggatgcatgtgaaaaccttagcggtgctgatcttgctgaattggtatgtttctac |
791004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University