View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11760_low_19 (Length: 238)
Name: NF11760_low_19
Description: NF11760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11760_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 34932865 - 34933087
Alignment:
| Q |
1 |
tgtgcgtatctcgatgggcatcccgctgagtatctcatctttgcgctatagatgttgaagatttgggagagagtcggcttcgcagataatatgaaagaac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932865 |
tgtgtgtatctcgatgggcatcccgctgagtatctcatctttgcactatagatgttgaagatttgggagagagtcggcttcgcagataatatgaaagaac |
34932964 |
T |
 |
| Q |
101 |
agaattgttagatggtaatta---gatgatgatgatatgtactaattaattaaacacactctatcaaaactaatataatcattccatcaaagaagagaaa |
197 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932965 |
aaaattgttagatggtaattagatgatgatgatgatatgtactaattaattaaacacactctatcaaaactaatataatcattccatcaaagaagagaaa |
34933064 |
T |
 |
| Q |
198 |
atcccgaattcataaggtttaaa |
220 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
34933065 |
atcccgaattcacaaggtttaaa |
34933087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University