View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11760_low_21 (Length: 225)

Name: NF11760_low_21
Description: NF11760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11760_low_21
NF11760_low_21
[»] chr3 (1 HSPs)
chr3 (1-130)||(51000542-51000672)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 51000542 - 51000672
Alignment:
1 gatagaatgattaaaaatacttgaacactgcannnnnnnn--aagacaacactgctaataaattttggatagattgtttgattaactttaaaaaatagtt 98  Q
    ||||||||||||||||||||||||||||||||          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
51000542 gatagaatgattaaaaatacttgaacactgcattttttttttaaggcaacactgctaataaattttggatagattgtttgattaactttaaaaaata-tt 51000640  T
99 cgcaaaattacgcaaacagtctcttaacttaa 130  Q
     |||||||||||||||||||| |||| |||||    
51000641 ggcaaaattacgcaaacagtcccttatcttaa 51000672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University