View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_high_12 (Length: 354)
Name: NF11761_high_12
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_high_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 13 - 354
Target Start/End: Original strand, 36333381 - 36333722
Alignment:
| Q |
13 |
gagagggaatatgcggagcatgtggcacatggactattcacatgttttaagggaaagaaagaaaccctgtgactgtgactgtgacaatcgacaagaagga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333381 |
gagagggaatatgcggagcatgtggcacatggactattcacatgttttaagggaaagaaagaaaccctgtgactgtgactgtgacaatcgacaagaagga |
36333480 |
T |
 |
| Q |
113 |
ggtgattgatattccaaatggcaacatcatcaacaaagaaggaggtgtattcagtgtgggcgatcccaccagaagacgtacgcgaccgccttaccaagct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36333481 |
ggtgattgatattccaaatggcaacatcatcaataaagaaggaggtgtattcagtgtgggcgatcccaccggaagacgtacgcgaccgccttaccaagct |
36333580 |
T |
 |
| Q |
213 |
catgacctccctccgatccgatttcggtggaccccagttcgaaccccacatgaccgtcgtgggagcaatagaattaaccccagacgacgcactcaaaaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36333581 |
catgacctccctccgatccgatttcggtggaccccagttcgaaccccacatgaccgtcgtgggagcaatagagttaaccccagacgacgcactcaaaaaa |
36333680 |
T |
 |
| Q |
313 |
ctccgatcagcgtctgaaggtgttaagtctttcaaagtcacc |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36333681 |
ctccgatcagcgtctgaaggtgttaagtctttccaagtcacc |
36333722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University