View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_high_18 (Length: 250)
Name: NF11761_high_18
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 37871524 - 37871320
Alignment:
| Q |
1 |
tttcccagctcagattctaacacttccattggatttatgttttcattggaagcttgttgttcaactctctcagaaggaagtgcattagcagcaggctgtg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37871524 |
tttcccagctcagattctaacacctccattggatttatgttttcattggaagcttgttgttcaactctctcagaaggaagtgcattagcagcaggctgtg |
37871425 |
T |
|
| Q |
101 |
gaatgagaaaaagacaatgctgagtgaacatatatgattctatacatgatttgtttattcaatcataaatccctgaatttagctccactaaagtaaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37871424 |
gaatgagaaaaagacaatgctgagtgaacatatatgattctatacatgatttgtttattcaatcagaaagccctgaatttagctccactaaagcaaacaa |
37871325 |
T |
|
| Q |
201 |
ttcaa |
205 |
Q |
| |
|
||||| |
|
|
| T |
37871324 |
ttcaa |
37871320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University