View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11761_low_17 (Length: 288)

Name: NF11761_low_17
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11761_low_17
NF11761_low_17
[»] chr8 (2 HSPs)
chr8 (175-288)||(40577680-40577793)
chr8 (1-34)||(40577934-40577967)
[»] chr4 (1 HSPs)
chr4 (206-246)||(734268-734308)
[»] chr3 (1 HSPs)
chr3 (206-246)||(45390661-45390701)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 175 - 288
Target Start/End: Complemental strand, 40577793 - 40577680
Alignment:
175 ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40577793 ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg 40577694  T
275 ttactgtgttctgt 288  Q
    ||||||||||||||    
40577693 ttactgtgttctgt 40577680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 40577967 - 40577934
Alignment:
1 ttgagcttctttctccgatcccaaaaccaccttc 34  Q
    ||||||||||||||||||||||||||||||||||    
40577967 ttgagcttctttctccgatcccaaaaccaccttc 40577934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 734308 - 734268
Alignment:
206 aaagttcacatgcattgtgaagcttgttcacaagaaatcaa 246  Q
    ||||||||||||||||||||||||||| || | ||||||||    
734308 aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa 734268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 45390701 - 45390661
Alignment:
206 aaagttcacatgcattgtgaagcttgttcacaagaaatcaa 246  Q
    ||||||||||||||||||||||||||| || | ||||||||    
45390701 aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa 45390661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University