View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_low_17 (Length: 288)
Name: NF11761_low_17
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_low_17 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 175 - 288
Target Start/End: Complemental strand, 40577793 - 40577680
Alignment:
| Q |
175 |
ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40577793 |
ggtgcagcctaaggttatcatagtgattctgaaagttcacatgcattgtgaagcttgttcacaagaaatcaagagacgcattgagaaaatcaaaggtatg |
40577694 |
T |
|
| Q |
275 |
ttactgtgttctgt |
288 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40577693 |
ttactgtgttctgt |
40577680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 40577967 - 40577934
Alignment:
| Q |
1 |
ttgagcttctttctccgatcccaaaaccaccttc |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40577967 |
ttgagcttctttctccgatcccaaaaccaccttc |
40577934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 734308 - 734268
Alignment:
| Q |
206 |
aaagttcacatgcattgtgaagcttgttcacaagaaatcaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
734308 |
aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa |
734268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 45390701 - 45390661
Alignment:
| Q |
206 |
aaagttcacatgcattgtgaagcttgttcacaagaaatcaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
45390701 |
aaagttcacatgcattgtgaagcttgtgcagaggaaatcaa |
45390661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University