View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11761_low_18 (Length: 252)

Name: NF11761_low_18
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11761_low_18
NF11761_low_18
[»] chr8 (2 HSPs)
chr8 (154-239)||(28313642-28313727)
chr8 (1-48)||(28313455-28313502)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 28313642 - 28313727
Alignment:
154 agagtgtttcggaagcaatcgttaacaagacccttagattaaataagaaaagtattttttgcatcatttttgcatctttctggtct 239  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||    
28313642 agagtgtttcggaagcaattgttaacaagacccttggattaaataagaaaagtactttttgcatcatttttgtatctttctggtct 28313727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 28313455 - 28313502
Alignment:
1 attctttcttggactttcagctctaacttgtattagaattaaattatg 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
28313455 attctttcttggactttcagctctaacttgtattagaattaaattatg 28313502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University