View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_low_18 (Length: 252)
Name: NF11761_low_18
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 28313642 - 28313727
Alignment:
| Q |
154 |
agagtgtttcggaagcaatcgttaacaagacccttagattaaataagaaaagtattttttgcatcatttttgcatctttctggtct |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
28313642 |
agagtgtttcggaagcaattgttaacaagacccttggattaaataagaaaagtactttttgcatcatttttgtatctttctggtct |
28313727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 28313455 - 28313502
Alignment:
| Q |
1 |
attctttcttggactttcagctctaacttgtattagaattaaattatg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28313455 |
attctttcttggactttcagctctaacttgtattagaattaaattatg |
28313502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University