View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_low_20 (Length: 250)
Name: NF11761_low_20
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 36333767 - 36333998
Alignment:
| Q |
1 |
tctcctcattcatcccacacctcagattctggaaaccaatgcgcactgctgcacccatttcggttacaagaactcaactcgtaagttttaacttttactc |
100 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36333767 |
tctcctccttcatcccacccctcagattctggaaaccaatgcgcactgctgcacccatttcggttataagaactcaactcgtaagttttaacttttactc |
36333866 |
T |
|
| Q |
101 |
tgatactcatcttttacatagttttgatgggttgaattaaatagattgttatgatgctttctctttattttgatcagatcactattgttccgctatacac |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333867 |
tgatactcatcttttacattgttttgatgggttgaatcaaatagattgttatgatgctttctctttattttgatcagatcactattgttccgctatacac |
36333966 |
T |
|
| Q |
201 |
tattttttacaaaatattgtcaattaggtgct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36333967 |
tattttttacaaaatattgtcaattaggtgct |
36333998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University