View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_low_21 (Length: 242)
Name: NF11761_low_21
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 225
Target Start/End: Original strand, 21536617 - 21536822
Alignment:
| Q |
20 |
ccagtctgctgggacaagactgtcatagttgtaatgaatgaggtgcgtatcagcagtccttatcacccggattgtgtgattggcggtgctcctgctgcca |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21536617 |
ccagtccgctgggacaagactgtcatagttgtaatgaatgaggtgcgtatcagcagtccttatcacccggattgtgtgaatggcggtgctcctgctgcca |
21536716 |
T |
 |
| Q |
120 |
atgaccgggtgaagaaagtgcttgagatgttgaggaagcgtttgcaacttccctgttctggtggtcagtagagttacaaaatgatcatttgaggtattga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21536717 |
atgaccgggtgaagaaagtgcttgagatgttgaggaagcgtttgcaacttccctgttctggtggtcagtagagttacaaaatgatcatttgaggtattga |
21536816 |
T |
 |
| Q |
220 |
gctctc |
225 |
Q |
| |
|
|||||| |
|
|
| T |
21536817 |
gctctc |
21536822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 20 - 139
Target Start/End: Complemental strand, 26480306 - 26480187
Alignment:
| Q |
20 |
ccagtctgctgggacaagactgtcatagttgtaatgaatgaggtgcgtatcagcagtccttatcacccggattgtgtgattggcggtgctcctgctgcca |
119 |
Q |
| |
|
|||||| ||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| | || ||||||||||| ||| |||||||||| | |
|
|
| T |
26480306 |
ccagtccgctgggacaagaccgtcatagtcgtgatgaatgaggtgcgcgtcagcagtccttatcactctgaatgtgtgattggtggtactcctgctgcaa |
26480207 |
T |
 |
| Q |
120 |
atgaccgggtgaagaaagtg |
139 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26480206 |
atgaccgggtgaagaaagtg |
26480187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University