View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11761_low_23 (Length: 214)
Name: NF11761_low_23
Description: NF11761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11761_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 355128 - 354933
Alignment:
| Q |
1 |
ttgagcaattttcttacagttttggatagagtgccttatgtgtttgcagttattgcagaacaacggttgtttttcatattctattttaacnnnnnnngcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
355128 |
ttgagcaattttcttacagttttggatagagtgccttatgtgtttgcagttattgcagaacaacggttgtttttcatattctattttaacaaaaaaagcg |
355029 |
T |
 |
| Q |
101 |
gactcttctcttcccacaagcaagttgttcaatattggttgcgacaaatccaaatcaataagtatgcgagcatagtgaccaaaggtacggatttta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
355028 |
gactcttctcttcccacaagcaagttgttcaatattggttgcgacaaatccaaatcaataagtatgcgagcatagtgaccaaaggtacggatttta |
354933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 10581529 - 10581332
Alignment:
| Q |
1 |
ttgagcaattttcttacagttttggatagagtgccttatgtgtttgcagttattgcagaacaacggttgtttttcatattctattttaac-nnnnnnngc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10581529 |
ttgagcaattttcttacagttttggatagagtgacttatgtgtttgcagttattgcagaacaacggttgtttttcatattctattttaacaaaaaaaagc |
10581430 |
T |
 |
| Q |
100 |
ggactcttctcttcccacaagcaagttgttcaatattggttgcgacaaatccaaatcaataagtatgcgagcatag-tgaccaaaggtacggatttta |
196 |
Q |
| |
|
| || |||||||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
10581429 |
gtacccttctctttccacaagcaagttgttgaatattggctgcgacaaatccaaatctgtaagtatgcgagcatagttgaccaaagatatggatttta |
10581332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University