View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11762_high_20 (Length: 249)
Name: NF11762_high_20
Description: NF11762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11762_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 1252337 - 1252555
Alignment:
| Q |
19 |
acctcccttgaggtttccccttaaacaaacgtttgttacttaaccccggccaccaccaaaaataaattcacagctgaatttccaatgctagnnnnnnnnt |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1252337 |
acctcccatgaggtttccccttaaacaaacgtttgttacttaaccccggccaccaacaaaaataaattcacagctgaatttccaatgctagaacgaaaat |
1252436 |
T |
 |
| Q |
119 |
taagatgttggtttgtcaaaagagaggttctataacatagatttctcatctttcacatagttttctggatctgt---cttcgtcagcttttcgattacga |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1252437 |
tacgatgttggtttgtcaaaagagaggttctataacatagatttctcatgtttcacatagttttctggatctgtcgacttcgtcagcttttcgattacga |
1252536 |
T |
 |
| Q |
216 |
ttttctctctcggatctgt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1252537 |
ttttctctctcggatctgt |
1252555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University