View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11762_low_19 (Length: 256)
Name: NF11762_low_19
Description: NF11762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11762_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 9 - 148
Target Start/End: Complemental strand, 14518301 - 14518162
Alignment:
| Q |
9 |
aggaggagcacagaatcgaactctagacaagaattggtggcgcactgcaacaaaggaacaaaaactaagaccaaaatgggatttttcgaaagaatggaaa |
108 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14518301 |
aggaggagaatagaatcgaactctagacaagagttggtggcgcactgcaacaaaggaacaaaaactaagaccaaaatgggattcttcgaaagaatggaaa |
14518202 |
T |
 |
| Q |
109 |
agatgagtgtatgtatctttatattcgcaaagtagtttcc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518201 |
agatgagtgtatgtatctttatattcgcaaagtagtttcc |
14518162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 9 - 115
Target Start/End: Complemental strand, 14535806 - 14535700
Alignment:
| Q |
9 |
aggaggagcacagaatcgaactctagacaagaattggtggcgcactgcaacaaaggaacaaaaactaagaccaaaatgggatttttcgaaagaatggaaa |
108 |
Q |
| |
|
|||||||| | ||||||||| ||| |||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14535806 |
aggaggagaatagaatcgaaatctggacaagaattggtggcagactgccacacaggaacaaaaactaagaccaaaatgggattttttgaaagaatggaaa |
14535707 |
T |
 |
| Q |
109 |
agatgag |
115 |
Q |
| |
|
|| |||| |
|
|
| T |
14535706 |
aggtgag |
14535700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 34 - 116
Target Start/End: Original strand, 37338146 - 37338228
Alignment:
| Q |
34 |
gacaagaattggtggcgcactgcaacaaaggaacaaaaactaagaccaaaatgggatttttcgaaagaatggaaaagatgagt |
116 |
Q |
| |
|
|||| |||||||||| | ||||| | ||||||||||||||||| |||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
37338146 |
gacaggaattggtggtgaactgccataaaggaacaaaaactaaaaccaaaatgggattcttcgaaagaatgcaaaaggtgagt |
37338228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University