View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11763_high_3 (Length: 254)
Name: NF11763_high_3
Description: NF11763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11763_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 254
Target Start/End: Original strand, 44542111 - 44542336
Alignment:
| Q |
29 |
ggtgttctctgtttctgtggttgttatgtcatcttgaggttcatcctctgtttctgtggttgttagtccttctcgaggttcatccttctcttcctctccc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44542111 |
ggtgttctctgtttctgtggttgttatgtcatcttgaggttcatcctctgtttctgtggttgttaggccttctcgaggttcatccttctcttcctctccc |
44542210 |
T |
 |
| Q |
129 |
gaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaaggcaatttcctgatgatggaagcaagtattac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44542211 |
gaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaaggcaatttcttgatgatggaagcaagtattac |
44542310 |
T |
 |
| Q |
229 |
tgggctcattgtcgattttcccctcc |
254 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
44542311 |
tgggctcattgttgattttcccctcc |
44542336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University