View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11764_high_10 (Length: 279)
Name: NF11764_high_10
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11764_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 45589729 - 45589460
Alignment:
| Q |
1 |
ttagaccgagctcatactgcgagttgatataaacatgagagtacaacgatcgagctaagaaccaacttttcacgacgcttaaccgatttaatgaatatga |
100 |
Q |
| |
|
|||| |||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45589729 |
ttaggccgagctcataccgcgagtgggtataaacatgagagtacaacgatcgagctaagaaccaacttttcacgacgctgaaccgatttaatgaatatga |
45589630 |
T |
 |
| Q |
101 |
atatgtttctcactgttctatagtcctaagacactaagtccattaagacatgtgccacttcccatataaggcaggtcttgccctaattatagtatctctc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45589629 |
atatgtttctcactgttctacggtcctaagacactaagtccattaagacatgtgccacttcccatataaggcaggtcttgccctaattatagtatctctc |
45589530 |
T |
 |
| Q |
201 |
agctttttac--------tcttgtattggattcgctttggaattaaaatgtcgttttatagacacccctt |
262 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45589529 |
agctttttactcttttactcttgtattggactcactttggaattaaaatgtcgttttatagatacccctt |
45589460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University