View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11764_high_7 (Length: 370)
Name: NF11764_high_7
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11764_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 89 - 351
Target Start/End: Original strand, 45589801 - 45590066
Alignment:
| Q |
89 |
aaatatcaagtaaata---atatttgagccccatttaaacatggcaaatgcatttttggccatatccgaaaattatcaatttttgaggataaaaccgaag |
185 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45589801 |
aaatatcaagtaaataataatatttgtgccccatttaaaaatgccaaatgcatttttggccatatccgaaaattatcaatttttgaggataaaaccgaag |
45589900 |
T |
 |
| Q |
186 |
gaaggaggttcaggcactagtacagtactggcgagagacatggatttacatggttatctgaacagaacaaccttccaaactctcaaactcagttccactc |
285 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45589901 |
gaaggaggtttaggcactagtacagtactggcgagagacatggatttacatggttatctgaacagaacaaccttccaaactctcaaactcagttcaactc |
45590000 |
T |
 |
| Q |
286 |
ccacatgttcctcttcgcgcttcctttctccttcacttcacaaaacccacaaatttccatttccac |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45590001 |
ccacatgttcctcttcgcgcttcctttctccttcacttcacaaaacccacaaatttccatttccac |
45590066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 45589755 - 45589797
Alignment:
| Q |
8 |
caatggagatggacaaaatatgaatagttctactcaaatccca |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45589755 |
caatggagatggacaaaatatgaatagttctactcaaatccca |
45589797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University