View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11764_low_11 (Length: 260)
Name: NF11764_low_11
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11764_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 23 - 255
Target Start/End: Complemental strand, 40503082 - 40502848
Alignment:
| Q |
23 |
aatcaaaaagatttaaaattgagatctcaaaatgag-atactctaaaatatcaagactacaacaccattcttaagaggtttttagaaaataaaattagtg |
121 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40503082 |
aatcgaaaagatttgaaatcgagatctcaaaatgaatatactctaaaatatcaagactacaacaccattcttaaaaggtttttagaaaataaaattagtg |
40502983 |
T |
 |
| Q |
122 |
ggacaacataacaactgtgtcccctnnnnnnn-catgacaattgtgtgagagtttgcaattttactatcaaattgagagcaataaaatattttatcgtga |
220 |
Q |
| |
|
||||||| | | |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40502982 |
ggacaacgtgaaaactgtgttccctaaaaaaaacatgacaattgtgtgagagtttgcaattttactatcaaattgagagcaataaaatattttattatga |
40502883 |
T |
 |
| Q |
221 |
attgctttttgtttcttattattacctttgcttct |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40502882 |
attgctttttgtttcttattattaccttttcttct |
40502848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University