View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11764_low_12 (Length: 253)
Name: NF11764_low_12
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11764_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 16948071 - 16947855
Alignment:
| Q |
15 |
cataggaactaaaatggccacttcaatttctgcaacaggttgtgttggttcatcattctatggaagctggggaacttctatagttggtgaagattacacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16948071 |
cataggaactaaaatggccacttcaatttctgcaacaggttgtgttggttcatcattctatggaagctggggaacttctatagttggtgaagattacacc |
16947972 |
T |
 |
| Q |
115 |
atgttgactaagtcagtttcttcgcaacttcgtattggaagagttagtaagccagtgaggttgcaacctatgatgaagaatgttaatgaagggaaaggta |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16947971 |
atgttggctaagtcagtttcttcgcaacttcgtattggaagagttagtaaaccagtgaggttgcaacctatgatgaagaatgttaatgaagggaaaggta |
16947872 |
T |
 |
| Q |
215 |
tttttgctccacttgtt |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16947871 |
tttttgctccacttgtt |
16947855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University