View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11764_low_13 (Length: 240)

Name: NF11764_low_13
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11764_low_13
NF11764_low_13
[»] chr6 (1 HSPs)
chr6 (19-144)||(1795396-1795520)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 144
Target Start/End: Complemental strand, 1795520 - 1795396
Alignment:
19 ttgaaattgttaatttttacttttaaatttattagaagtgnnnnnnnataatgtaaaagttgaattagacacgtatgtttatactaaagtttagatataa 118  Q
    |||||||||||||||||||||||||| | ||||| |||||       ||| |||| |||||||| |||||||||||| |||||||||||||||| |||||    
1795520 ttgaaattgttaatttttacttttaagtctattaaaagtgtttttt-atagtgtagaagttgaactagacacgtatgcttatactaaagtttagttataa 1795422  T
119 ttgtaaagatgctcgataaaataata 144  Q
    ||||||||||||||||||||||||||    
1795421 ttgtaaagatgctcgataaaataata 1795396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University