View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11764_low_13 (Length: 240)
Name: NF11764_low_13
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11764_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 144
Target Start/End: Complemental strand, 1795520 - 1795396
Alignment:
| Q |
19 |
ttgaaattgttaatttttacttttaaatttattagaagtgnnnnnnnataatgtaaaagttgaattagacacgtatgtttatactaaagtttagatataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| ||||| ||| |||| |||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
1795520 |
ttgaaattgttaatttttacttttaagtctattaaaagtgtttttt-atagtgtagaagttgaactagacacgtatgcttatactaaagtttagttataa |
1795422 |
T |
 |
| Q |
119 |
ttgtaaagatgctcgataaaataata |
144 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1795421 |
ttgtaaagatgctcgataaaataata |
1795396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University