View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11764_low_8 (Length: 304)
Name: NF11764_low_8
Description: NF11764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11764_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 172 - 289
Target Start/End: Complemental strand, 34669441 - 34669324
Alignment:
| Q |
172 |
tttcaagattttatccatacatgatatacgtccactcttgttctttatgtgtctttcagaatatgatgttactcaacatagatattgttgtgacagttaa |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
34669441 |
tttcaagattttatccatacatgatatacgtccgctcttgttctttatgtgtcttatagaatatgatgttactgaacatagatattgttgtgatagttaa |
34669342 |
T |
|
| Q |
272 |
agtaaactcttgcttcat |
289 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34669341 |
agtaaactcttgcttcat |
34669324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 15 - 156
Target Start/End: Complemental strand, 18186964 - 18186822
Alignment:
| Q |
15 |
agccaaatgtttaggttctgaggtacacaccttccaatccttctcaatttcaaatttggctgcaagatttttggtagtcttatatatgcatatacctgaa |
114 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| || |||||| | ||||||||| | |
|
|
| T |
18186964 |
agccaaagggttaggttctgaggtacacacctttcaatccttcttaatttcaaattcggctgcaagatttttggcagcattatatgtaaatatacctgta |
18186865 |
T |
|
| Q |
115 |
taaaagaaatgatccaattttatatgcatt-atattttgagct |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18186864 |
taaaagaaatgatccaattttatatgcattggtattttgagct |
18186822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 205 - 289
Target Start/End: Complemental strand, 18186602 - 18186518
Alignment:
| Q |
205 |
actcttgttctttatgtgtctttcagaatatgatgttactcaacatagatattgttgtgacagttaaagtaaactcttgcttcat |
289 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |||||||| |||||| | || ||||||| |||| ||||||||||| |
|
|
| T |
18186602 |
actcctgttctttatgtgtcttttagaatatgatgttagtcaacatatatattgctctggtagttaaattaaaatcttgcttcat |
18186518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 24833410 - 24833350
Alignment:
| Q |
15 |
agccaaatgtttaggttctgaggtacacaccttccaatccttctcaatttcaaatttggct |
75 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24833410 |
agccaaatggttaggttatgaggtacacaccttccaatccttctcaatttcaaatttggct |
24833350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University