View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11765_high_2 (Length: 275)
Name: NF11765_high_2
Description: NF11765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11765_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 178 - 260
Target Start/End: Complemental strand, 26165927 - 26165845
Alignment:
| Q |
178 |
ttttttcccccttatctctcatggatatcatgtttcctaactttataaccatcgttttattcaccctcacttggcttgaccgc |
260 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26165927 |
tttttttccccttatctctcatggatgtcatgtttcctaactttataaccatcgtagtattcaccctcacttggcttgaccgc |
26165845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University