View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11765_low_2 (Length: 275)

Name: NF11765_low_2
Description: NF11765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11765_low_2
NF11765_low_2
[»] chr2 (1 HSPs)
chr2 (178-260)||(26165845-26165927)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 178 - 260
Target Start/End: Complemental strand, 26165927 - 26165845
Alignment:
178 ttttttcccccttatctctcatggatatcatgtttcctaactttataaccatcgttttattcaccctcacttggcttgaccgc 260  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
26165927 tttttttccccttatctctcatggatgtcatgtttcctaactttataaccatcgtagtattcaccctcacttggcttgaccgc 26165845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University