View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11766_high_23 (Length: 236)
Name: NF11766_high_23
Description: NF11766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11766_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 15907476 - 15907256
Alignment:
| Q |
1 |
tgattaatatctttatggttttccttgaatcatggttggnnnnnnnnnnnnnnnnnggacggatgaatccaagcactgaagaatttggagataggtcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15907476 |
tgattaatatctttatggttttccttgaatcatggttggaaaaaataaaaataaaaggacggatgaatccaagtactgaagaatttggagataggtcata |
15907377 |
T |
 |
| Q |
101 |
gacagcatgaagacacttggcagttcatattctttaggtttgaaacatcaacaaagcaaccaggtgaacaattttttatataaaaactggaatattaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15907376 |
gacagcatgaagacacttggcagttcatattctttaggtttgaaacatcaacaaagcaaccaggtgaacaattttttatataaaaactggaatattaatc |
15907277 |
T |
 |
| Q |
201 |
atgttgttgaggtaataattt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15907276 |
atgttgttgaggtaataattt |
15907256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University