View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11766_high_24 (Length: 230)
Name: NF11766_high_24
Description: NF11766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11766_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 38777647 - 38777857
Alignment:
| Q |
1 |
gtgtttagggcagtcacgtttctacaggatgggtggcaagcaaagcaactattgcctccaattcaagtgacttcaaggactcctcggataaacacttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38777647 |
gtgtttagggcagtcacgtttctacaggatgggtggcaagcaaagcaactattgcctccaattcaagtgacttcaaggactcctcggataaacacttgga |
38777746 |
T |
|
| Q |
101 |
ttgcaccacctacttgataatataacgtggatactaggttttttgttacaggaattgatgaatattttaaactgcactatcgttagtccccaattttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38777747 |
ttgcaccacctacttgataatataacgtggatactaggttttttgttacaggaattgatgaatattttaaactgcactatcgttagtcgccaattttttg |
38777846 |
T |
|
| Q |
201 |
acggtgtcttc |
211 |
Q |
| |
|
|| |||||||| |
|
|
| T |
38777847 |
acagtgtcttc |
38777857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University