View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11766_high_26 (Length: 207)
Name: NF11766_high_26
Description: NF11766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11766_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 5665238 - 5665048
Alignment:
| Q |
18 |
aatgtggtggctcaatgtacaactgagatgatgcttcttgcatccaatttaccgctccaaacatgtaattaacgatcagag--ggtggagtagtggatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5665238 |
aatgtggtggctcaatgtacaactgagatgatgcttcttgcatccaatttgccgctccaaacatgtaattaacgatcagagagggtggagtagtggatat |
5665139 |
T |
 |
| Q |
116 |
tcagctgttggttgctcttgtggttgagactgctcctctggttcattcggaatccctcctgcctccctcagtttgctgatgtccatctcat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
5665138 |
tcagctgttggttgctcttgtggttgagactgctcttctggttcattcggaatccctcctgcctccctcagtttgctcatgtacttctcat |
5665048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University