View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11766_low_14 (Length: 317)

Name: NF11766_low_14
Description: NF11766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11766_low_14
NF11766_low_14
[»] chr8 (1 HSPs)
chr8 (20-307)||(7524620-7524907)


Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 7524907 - 7524620
Alignment:
20 ctagagatactgaaggacatggaacacatacagcttcaacagcagctggatcagttgttggtaatgctagtttgtttggtttcgctagaggcgaagctaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7524907 ctagagatactgaaggacatggaacacatacagcttcaacagcagctggatcagttgttggtaatgctagtttgtttggtttcgctagaggcgaagctaa 7524808  T
120 gggaatggcaacaaaagctagaattgctgcttataaaatctgttggaaacttggttgttttgattctgatattcttgctgctatggatgaagctgttgct 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7524807 gggaatggcaacaaaagctagaattgctgcttataaaatctgttggaaacttggttgttttgattctgatattcttgctgctatggatgaagctgttgct 7524708  T
220 gatggggttcatgtgatttcgctttcggttggttctagtggttatgcgcctcattattatcgtgattcgattgctattggtgcctttg 307  Q
    |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||    
7524707 gatggggttcatgtgatttcactttcggttggttctaatggttatgcgcctcattattatcgtgattcgattgctatcggtgcttttg 7524620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University