View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11766_low_23 (Length: 240)
Name: NF11766_low_23
Description: NF11766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11766_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5606240 - 5606018
Alignment:
| Q |
1 |
ccatgcttgccatacccggacaaaagagcattgtaggttactacatctctattgattccgcttctctccatctctttgcacttctcaatagcttcatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5606240 |
ccatgcttgccatacccggacaaaagagcattgtaggttactacatctctattgattccgcttctctccatctctttgcacttctcaatagcttcatcaa |
5606141 |
T |
 |
| Q |
101 |
gattgccgagcttctcgtagattccgatgagtgtgttataggacactctatcaagacaaacagatcggagcttcatttcttcatacaggtttagggcgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5606140 |
gattgccgagcttctcgtagattccgacgagtgtgttataggacactctatcaagacaaacagatcggagcttcatttcttcatacaggtttagggcgtc |
5606041 |
T |
 |
| Q |
201 |
ttccaagaggttggccttggcat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5606040 |
ttccaagaggttggccttggcat |
5606018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 5594687 - 5594893
Alignment:
| Q |
16 |
ccggacaaaagagcattgtaggttactacatctctattgattccgcttctctccatctctttgcacttctcaatagcttcatcaagattgccgagcttct |
115 |
Q |
| |
|
||||||||||| ||||| || ||||| |||||||| || ||||| | ||||||||||||||||| | |||| |||||||||| | ||||||||| |
|
|
| T |
5594687 |
ccggacaaaagtgcattataagttacaacatctcttttcattccacaactctccatctctttgcattgaccaatggcttcatcaaacctaccgagcttcg |
5594786 |
T |
 |
| Q |
116 |
cgtagattccgatgagtgtgttataggacactctatcaagacaaacagatcggagcttcatttcttcatacaggtttagggcgtcttccaagaggttggc |
215 |
Q |
| |
|
| |||||||||| | ||||||||||||||||||||||| | ||| |||||| |||||||||||||| |||| |||||||| |||||||||||||| || |
|
|
| T |
5594787 |
catagattccgaccattgtgttataggacactctatcaacagaaatagatcgaagcttcatttcttcgtacaaatttagggcatcttccaagaggttagc |
5594886 |
T |
 |
| Q |
216 |
cttggca |
222 |
Q |
| |
|
||||||| |
|
|
| T |
5594887 |
cttggca |
5594893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University